Sync Nucleotide Count exercise

Simplified tests and implementation.

Author: verdammelt

exercises/practice/nucleotide-count/.meta/example.lisp

@@ -4,19 +4,8 @@
 
 (in-package :nucleotide-count)
 
-(define-condition invalid-nucleotide (error) ())
-
-(defparameter +valid-nucleotides+ "ACGT")
-
-(defun validate-nucleotide (nucleotide)
-  (or (find nucleotide +valid-nucleotides+)
-      (error 'invalid-nucleotide)))
-
-(defun dna-count (nucleotide strand)
-  (validate-nucleotide nucleotide)
-  (count nucleotide strand))
+(defparameter +valid-nucleotides+ (list #\A #\C #\G #\T))
 
 (defun nucleotide-counts (strand)
-  (reduce #'(lambda (h c) (setf (gethash c h) (dna-count c strand)) h)
-          +valid-nucleotides+
-          :initial-value (make-hash-table)))
+  (when (every #'(lambda (n) (member n +valid-nucleotides+ :test #'char=)) strand)
+    (mapcar #'(lambda (n) (cons n (count n strand :test #'char=))) +valid-nucleotides+)))

exercises/practice/nucleotide-count/nucleotide-count-test.lisp

@@ -15,38 +15,29 @@
 ;; Define and enter a new FiveAM test-suite
 (def-suite* nucleotide-count-suite)
 
-(defun make-hash (kvs)
-  (reduce #'(lambda (h kv) (setf (gethash (first kv) h) (second kv)) h) kvs
-          :initial-value (make-hash-table)))
-
-(test empty-dna-strand-has-no-adenine
- (is (equal 0 (nucleotide-count:dna-count #\A ""))))
-
-(test empty-dna-strand-has-no-nucleotides
- (is
-  (equalp (make-hash '((#\A 0) (#\T 0) (#\C 0) (#\G 0)))
-          (nucleotide-count:nucleotide-counts ""))))
-
-(test repetitive-cytosine-gets-counted
- (is (equal 5 (nucleotide-count:dna-count #\C "CCCCC"))))
-
-(test repetitive-sequence-has-only-guanine
- (is
-  (equalp (make-hash '((#\A 0) (#\T 0) (#\C 0) (#\G 8)))
-          (nucleotide-count:nucleotide-counts "GGGGGGGG"))))
-
-(test counts-only-thymine
- (is (equal 1 (nucleotide-count:dna-count #\T "GGGGGTAACCCGG"))))
-
-(test validates-nucleotides
- (signals nucleotide-count:invalid-nucleotide
-  (nucleotide-count:dna-count #\X "GACT")))
-
-(test counts-all-nucleotides
- (is
-  (equalp (make-hash '((#\A 20) (#\T 21) (#\G 17) (#\C 12)))
-          (nucleotide-count:nucleotide-counts
-           "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"))))
+(test empty-strand
+    (let ((strand "")
+          (result '((#\A . 0) (#\C . 0) (#\G . 0) (#\T . 0))))
+      (is (equal result (nucleotide-count:nucleotide-counts strand)))))
+
+(test can-count-one-nucleotide-in-single-character-input
+    (let ((strand "G")
+          (result '((#\A . 0) (#\C . 0) (#\G . 1) (#\T . 0))))
+      (is (equal result (nucleotide-count:nucleotide-counts strand)))))
+
+(test strand-with-repeated-nucleotide
+    (let ((strand "GGGGGGG")
+          (result '((#\A . 0) (#\C . 0) (#\G . 7) (#\T . 0))))
+      (is (equal result (nucleotide-count:nucleotide-counts strand)))))
+
+(test strand-with-multiple-nucleotides
+    (let ((strand "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
+          (result '((#\A . 20) (#\C . 12) (#\G . 17) (#\T . 21))))
+      (is (equal result (nucleotide-count:nucleotide-counts strand)))))
+
+(test strand-with-invalid-nucleotides
+    (let ((strand "AGXXACT"))
+      (is (equal NIL (nucleotide-count:nucleotide-counts strand)))))
 
 (defun run-tests (&optional (test-or-suite 'nucleotide-count-suite))
   "Provides human readable results of test run. Default to entire suite."

exercises/practice/nucleotide-count/nucleotide-count.lisp

@@ -1,13 +1,7 @@
 (defpackage :nucleotide-count
   (:use :cl)
-  (:export :dna-count :nucleotide-counts :invalid-nucleotide))
+  (:export :nucleotide-counts))
 
 (in-package :nucleotide-count)
 
-(defun dna-count (nucleotide strand)
-  "Returns a count of the given nucleotide appearing in a DNA strand."
-  )
-
-(defun nucleotide-counts (strand)
-  "Returns a hash of nucleotides and their counts in a given DNA strand."
-  )
+(defun nucleotide-counts (strand))